Prev. |  KEGG KO K20724 > 

RIKEN DNA Bank Human Resource - TMEM33

Gene ID NCBI Gene 55161 |  KEGG hsa:55161
Gene Symbol TMEM33
Protein Name transmembrane protein 33
Synonyms 1600019D15Rik|Pom33|SHINC-3|SHINC3
Ortholog resource in our bank

  TMEM33

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001466 IRAK003L02 pCMV-SPORT6 BC000948 NM_018126 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004939 W01A012F19 pENTR-TOPO flj0033m12 AK001387 NM_018126  
HGE004969 W01A012H01 pENTR-TOPO IRAK003L02 BC000948 NM_018126  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR373603 RBd34A03 pGCAP10 NM_018126.1  
GACCTTCGCTCCCGTCTTTCTGGAAACACCGCTTTGATCTCGGCGGTGCGGGACAGGTAC
HKR406041 RBdS015B17 pGCAP10 NM_018126.1  
GCTCTTTANGGCTTCACCCCGAAGCTCCACCTTCGCTCCCGTCTTTCTGGAAACACCGCT
HKR475136 RBdS187N24 pGCAP10 NM_018126.1  
GAGCTCCACCTTCGCTCCCGTCTTTCTGGAAACACCGCTTTGATCTCGGCGGTGCGGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl