Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07798

HP ID(1) HP07798
Gene ID(2) 23590
Gene Symbol finder PDSS1
Protein Name prenyl (decaprenyl) diphosphate synthase, subunit 1
RefSeq NM_014317.3
Length of RefSeq (bp) 1679
Chromosome 10p12.1
Reference DDBJ accession
UniGene Hs.558468

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd33G02 pGCAP10 GATCGCGGGCCAGAGGCGGAGCCGCCGCCCTGCCGCGACTTTCAGACTCCGACCATGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl