Prev. |  KEGG KO K12504 > 

RIKEN DNA Bank Human Resource - PDSS1

Gene ID NCBI Gene 23590 |  KEGG hsa:23590
Gene Symbol PDSS1
Protein Name decaprenyl diphosphate synthase subunit 1
Synonyms COQ1|COQ10D2|COQ1A|DPS|SPS|TPRT|TPT|TPT 1|hDPS1
Ortholog resource in our bank

  PDSS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037480 IRAK093L16 pCMV-SPORT6 BC049211 NM_014317 Partial
HGX053779 IRAK134H11 pCMV-SPORT6 BC063635 NM_014317 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR373346 RBd33G02 pGCAP10 NM_014317.3  
GATCGCGGGCCAGAGGCGGAGCCGCCGCCCTGCCGCGACTTTCAGACTCCGACCATGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl