Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07796

HP ID(1) HP07796
Gene ID(2) 5191
Gene Symbol finder PEX7
Protein Name peroxisomal biogenesis factor 7
RefSeq NM_000288.3
Length of RefSeq (bp) 1499
Chromosome 6q23.3
Reference DDBJ accession
UniGene Hs.280932

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd33B04 pGCAP10 GGGGGCAGCGAGGGCCGGGGGCGGCGGGCGGGATGAGTGCGGTGTGCGGTGGAGCGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl