Prev. |  KEGG KO K13341 > 

RIKEN DNA Bank Human Resource - PEX7

Gene ID NCBI Gene 5191 |  KEGG hsa:5191
Gene Symbol PEX7
Protein Name peroxisomal biogenesis factor 7
Synonyms PBD9B|PTS2R|RCDP1|RD
Ortholog resources KEGG ortholog (KEGG orthology K13341) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR373228 RBd33B04 pGCAP10 NM_000288.3  
GGGGGCAGCGAGGGCCGGGGGCGGCGGGCGGGATGAGTGCGGTGTGCGGTGGAGCGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl