Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07792

HP ID(1) HP07792
Gene ID(2) 6871
Gene Symbol finder TADA2L
Protein Name transcriptional adaptor 2 (ADA2 homolog, yeast)-like
RefSeq NM_001488.3
Length of RefSeq (bp) 1886
Chromosome 17q12-q21
Reference DDBJ accession
UniGene Hs.500066

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd32H09 pGCAP10 GGCGGATTAGGGGGTCTCGGCGAGGGAGTCATCAAGCTTTGGTGTATGTGTTGGCCGGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl