Prev. |  KEGG KO K11314 > 

RIKEN DNA Bank Human Resource - TADA2A

Gene ID NCBI Gene 6871 |  KEGG hsa:6871
Gene Symbol TADA2A
Protein Name transcriptional adaptor 2A
Synonyms ADA2|ADA2A|KL04P|TADA2L|hADA2
Ortholog resource in our bank

  TADA2A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082450 IRAL006C02 pOTB7 BC001172 NM_133439 Full/var
HGY090880 IRAL027D08 pOTB7 BC011753 NM_001488 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372977 RBd32H09 pGCAP10 NM_001488.3  
GGCGGATTAGGGGGTCTCGGCGAGGGAGTCATCAAGCTTTGGTGTATGTGTTGGCCGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl