Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07782

HP ID(1) HP07782
Gene ID(2) 23210
Gene Symbol finder JMJD6
Protein Name jumonji domain containing 6
RefSeq NM_015167.2
Length of RefSeq (bp) 1834
Chromosome 17q25
Reference DDBJ accession
UniGene Hs.514505

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd31F03 pGCAP10 GAGTGTCAGGAAGCGGGCTGCGCCGAGGTCGTAGCGGAACCAGCTGGCGACCCCGCAGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl