Prev. |  KEGG KO K11323 > 

RIKEN DNA Bank Human Resource - JMJD6

Gene ID NCBI Gene 23210 |  KEGG hsa:23210
Gene Symbol JMJD6
Protein Name jumonji domain containing 6, arginine demethylase and lysine hydroxylase
Synonyms PSR|PTDSR|PTDSR1
Ortholog resource in our bank

  JMJD6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037217 IRAK093A17 pCMV-SPORT6 BC047003 NM_015167 Partial
HGX056128 IRAK140F08 pCMV-SPORT6 BC066654 NM_015167 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372523 RBd31F03 pGCAP10 NM_015167.2  
GAGTGTCAGGAAGCGGGCTGCGCCGAGGTCGTAGCGGAACCAGCTGGCGACCCCGCAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl