Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07767

HP ID(1) HP07767
Gene ID(2) 8828
Gene Symbol finder NRP2
Protein Name neuropilin 2
RefSeq NM_003872.2
Length of RefSeq (bp) 6656
Chromosome 2q33.3
Reference DDBJ accession
UniGene Hs.471200

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd30A06 pGCAP10 GAGTGGGGAGCCGGAGGGGAGGCAGAGATCGCGAGCGAGGCACCAGCCTGCAGCCGGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl