Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NRP2

Gene ID (NCBI) 8828
Gene Symbol NRP2
Protein Name neuropilin 2
Synonyms NP2|NPN2|PRO2714|VEGF165R2
Databases KEGG hsa:8828 |  NCBI Gene 8828
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06819)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR372006 RBd30A06 pGCAP10 NM_003872.2 done
GAGTGGGGAGCCGGAGGGGAGGCAGAGATCGCGAGCGAGGCACCAGCCTGCAGCCGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.11.14

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180829.pl