RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - NRP2

Gene ID	NCBI Gene 8828 \| KEGG hsa:8828
Gene Symbol	NRP2
Protein Name	neuropilin 2
Synonyms	NP2\|NPN2\|PRO2714\|VEGF165R2

Ortholog resource in our bank

  NRP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR372006	RBd30A06	pGCAP10	NM_003872.2
HKR372006	GAGTGGGGAGCCGGAGGGGAGGCAGAGATCGCGAGCGAGGCACCAGCCTGCAGCCGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl