Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07764

HP ID(1) HP07764
Gene ID(2) 25788
Gene Symbol finder RAD54B
Protein Name RAD54 homolog B (S. cerevisiae)
RefSeq NM_012415.2
Length of RefSeq (bp) 3057
Chromosome 8q21.3-q22
Reference DDBJ accession
UniGene Hs.30561

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi01F01 pGCAP10 GGATAGCTGGTTACCAGAAGGACTTCTTTGCAGGGCCAGTGGTTTCTGTCAGATTTTCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl