Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07762

HP ID(1) HP07762
Gene ID(2) 55041
Gene Symbol finder PLEKHB2
Protein Name pleckstrin homology domain containing, family B (evectins) member 2
RefSeq NM_001031706.1
Length of RefSeq (bp) 1197
Chromosome 2q21.1
Reference DDBJ accession
UniGene Hs.469944

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi01E01 pGCAP10 GAGTTGCAGGCGAGCAGGCGAGGAATCGCCGTGGCGTCTTGGTGTTCTCCACGCTGGTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl