Prev. | 

RIKEN DNA Bank Human Resource - PLEKHB2

Gene ID NCBI Gene 55041 |  KEGG hsa:55041
Gene Symbol PLEKHB2
Protein Name pleckstrin homology domain containing B2
Synonyms EVT2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044272 IRAK110L08 pCMV-SPORT6 BC050695 NM_017958 Full/var
HGY081948 IRAL004O12 pOTB7 BC001428 NM_017958
HGY091277 IRAL028D05 pOTB7 BC013991 NM_017958 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR160497 ARi01E01 pGCAP10 NM_001031706.1  
GAGTTGCAGGCGAGCAGGCGAGGAATCGCCGTGGCGTCTTGGTGTTCTCCACGCTGGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl