Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07741

HP ID(1) HP07741
Gene ID(2) 29893
Gene Symbol finder PSMC3IP
Protein Name PSMC3 interacting protein
RefSeq NM_013290.4
Length of RefSeq (bp) 1417
Chromosome 17q12-q21
Reference DDBJ accession
UniGene Hs.383019

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi36H08 pGCAP10 TGAGGCCGGGCAGAAGCTGCGGCGGGAGCCGCCGGGATCCTCCTGAGGTACCTGCAGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl