Prev. |  KEGG KO K06695 > 

RIKEN DNA Bank Human Resource - PSMC3IP

Gene ID NCBI Gene 29893 |  KEGG hsa:29893
Gene Symbol PSMC3IP
Protein Name PSMC3 interacting protein
Synonyms GT198|HOP2|HUMGT198A|ODG3|TBPIP
Ortholog resource in our bank

  PSMC3IP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084847 IRAL012B23 pOTB7 BC008792 NM_016556 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE112425 M01C081B01 pDONR221 IMS04-C01 BC008792 NM_013290  
HGE112473 M01C081D01 pDONR221 IMS04-C01 BC008792 NM_013290  
HGE112521 M01C081F01 pDONR221 IMS04-C01 BC008792 NM_013290  
HGE112569 M01C081H01 pDONR221 IMS04-C01 BC008792 NM_013290  
HGE112617 M01C081J01 pDONR221 IMS04-C01 BC008792 NM_013290  
HGE112665 M01C081L01 pDONR221 IMS04-C01 BC008792 NM_013290  
HGE112713 M01C081N01 pDONR221 IMS04-C01 BC008792 NM_013290  
HGE112761 M01C081P01 pDONR221 IMS04-C01 BC008792 NM_013290  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024710 W01A061M22 pENTR-TOPO IRAL012B23 BC008792 NM_016556  
HGE024712 W01A061M24 pENTR-TOPO IRAL012B23 BC008792 NM_016556  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174576 ARi36H08 pGCAP10 NM_013290.4  
TGAGGCCGGGCAGAAGCTGCGGCGGGAGCCGCCGGGATCCTCCTGAGGTACCTGCAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl