Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07737

HP ID(1) HP07737
Gene ID(2) 7423
Gene Symbol finder VEGFB
Protein Name vascular endothelial growth factor B
RefSeq NM_003377.3
Length of RefSeq (bp) 1172
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.78781

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi36D05 pGCAP10 GGCCGTCCCCGCCGCCGCTGCCCGCCGCCACCGGCCGCCCGCCCGNCCGGCTCCTCCGGT
RBdS104O10 pGCAP10 GGGGGNGCGCGTGTCTGGGTCACATGAGCCGCCTGCCCGCCAGCCCGGGCNNTNNGANNN

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl