Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07720

HP ID(1) HP07720
Gene ID(2) 10908
Gene Symbol finder PNPLA6
Protein Name patatin-like phospholipase domain containing 6
RefSeq NM_006702.3
Length of RefSeq (bp) 4466
Chromosome 19p13.3-p13.2
Reference DDBJ accession
UniGene Hs.631863

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi34F11 pGCAP10 GAGCAATGGCGCCACCATCGGTCCCGGAGTCCCAGTGATGCTCTGTGCCATAGAGCCCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl