Prev. |  KEGG KO K14676 > 

RIKEN DNA Bank Human Resource - PNPLA6

Gene ID NCBI Gene 10908 |  KEGG hsa:10908
Gene Symbol PNPLA6
Protein Name patatin like phospholipase domain containing 6
Synonyms BNHS|LNMS|NTE|NTEMND|OMCS|SPG39|iPLA2delta|sws
Ortholog resource in our bank

  PNPLA6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027332 IRAK068F12 pCMV-SPORT6 BC038229 NM_006702 Partial/var
HGX039366 IRAK098G22 pCMV-SPORT6 BC051768 NM_006702 Full/var
HGX042970 IRAK107H02 pCMV-SPORT6 BC050553 NM_006702 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095208 M01C038A08 pDONR221 MGC08-F04 BC050553 NM_006702  
HGE095256 M01C038C08 pDONR221 MGC08-F04 BC050553 NM_006702  
HGE095304 M01C038E08 pDONR221 MGC08-F04 BC050553 NM_006702  
HGE095352 M01C038G08 pDONR221 MGC08-F04 BC050553 NM_006702  
HGE095400 M01C038I08 pDONR221 MGC08-F04 BC050553 NM_006702  
HGE095448 M01C038K08 pDONR221 MGC08-F04 BC050553 NM_006702  
HGE095496 M01C038M08 pDONR221 MGC08-F04 BC050553 NM_006702  
HGE095544 M01C038O08 pDONR221 MGC08-F04 BC050553 NM_006702  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR173731 ARi34F11 pGCAP10 NM_006702.3  
GAGCAATGGCGCCACCATCGGTCCCGGAGTCCCAGTGATGCTCTGTGCCATAGAGCCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl