Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07718

HP ID(1) HP07718
Gene ID(2) 55718
Gene Symbol finder POLR3E
Protein Name polymerase (RNA) III (DNA directed) polypeptide E (80kD)
RefSeq NM_018119.2
Length of RefSeq (bp) 2640
Chromosome 16p12.1
Reference DDBJ accession
UniGene Hs.460298

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi34B10 pGCAP10 GGTTTCTCCACCAGCAACATGGCCGCCGCCTGAGAGGAGAGCCGGGCCGCCGCCGTCTCT
RBd35A11 pGCAP10 GAGCTCTGGGAGGGACACGGTTGGAACGGAATTTAAACGACCTGTGCTAGGAAAGGAAGG
RBd84F01 pGCAP10 GGCCGGAGTTTCTCCACCAGCAACATGGCCGCCGCCTGAGAGGAGAGCCGGGCCGCCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl