Prev. |  KEGG KO K14721 > 

RIKEN DNA Bank Human Resource - POLR3E

Gene ID NCBI Gene 55718 |  KEGG hsa:55718
Gene Symbol POLR3E
Protein Name RNA polymerase III subunit E
Synonyms RPC5|SIN
Ortholog resources KEGG ortholog (KEGG orthology K14721) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082602 IRAL006I10 pOTB7 BC000285 NM_018119 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE022958 W01A057G14 pENTR-TOPO flj0033o06 AK001371 NM_018119  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173634 ARi34B10 pGCAP10 NM_018119.2  
GGTTTCTCCACCAGCAACATGGCCGCCGCCTGAGAGGAGAGCCGGGCCGCCGCCGTCTCT
HKR374011 RBd35A11 pGCAP10 NM_018119.2  
GAGCTCTGGGAGGGACACGGTTGGAACGGAATTTAAACGACCTGTGCTAGGAAAGGAAGG
HKR393721 RBd84F01 pGCAP10 NM_018119.2  
GGCCGGAGTTTCTCCACCAGCAACATGGCCGCCGCCTGAGAGGAGAGCCGGGCCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl