Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07714

HP ID(1) HP07714
Gene ID(2) 55591
Gene Symbol finder VEZT
Protein Name vezatin, adherens junctions transmembrane protein
RefSeq NM_017599.3
Length of RefSeq (bp) 4580
Chromosome 12q22
Reference DDBJ accession
UniGene Hs.24135

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi33C03 pGCAP10 GAAGAGGAAAATGGCGGTGGGTGTGGATTGCCTTTGTTTGAGAAGGACGAGACGGAAATC
RBd91B02 pGCAP10 GGAGGCGGGTGGCATGGCGGAGAAGGATGACACCGGAGTTTGACGAAGAGGTGGTTTTTG
RBd93D03 pGCAP10 GGAGGCGGGTGGCATGGCGGAGAAGGATGACACCGGAGTTTGACGAAGAGGTGGTTTTTG
RBdS007J17 pGCAP10 GGCTGAGGCGGGTGGCATGGCGGAGAAGGATGACACCGGAGTTTGACGAAGAGGTGGTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl