Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07697

HP ID(1) HP07697
Gene ID(2) 23556
Gene Symbol finder PIGN
Protein Name phosphatidylinositol glycan anchor biosynthesis, class N
RefSeq NM_176787.4
Length of RefSeq (bp) 4893
Chromosome 18q21.33
Reference DDBJ accession
UniGene Hs.157031

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi31B01 pGCAP10 GGCGTTCCGGAATTGAGGGGTGGTTGTAGTGGTGGCTTAGGAATACCCTCCCGGCTATCG
ARiS118M04 pGCAP10 GGCAGGTATTGGGGGCGTTCCGGAATTGAGGGGTGGTTGTAGTGGTGGCTTAGGAATACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl