Prev. |  KEGG KO K05285 > 

RIKEN DNA Bank Human Resource - PIGN

Gene ID NCBI Gene 23556 |  KEGG hsa:23556
Gene Symbol PIGN
Protein Name phosphatidylinositol glycan anchor biosynthesis class N
Synonyms MCAHS|MCAHS1|MCD4|MDC4|PIG-N
Ortholog resources KEGG ortholog (KEGG orthology K05285) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013559 IRAK033O23 pBluescriptR BC028363 NM_176787 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172425 ARi31B01 pGCAP10 NM_176787.4  
GGCGTTCCGGAATTGAGGGGTGGTTGTAGTGGTGGCTTAGGAATACCCTCCCGGCTATCG
HKR247492 ARiS118M04 pGCAP10 NM_176787.4  
GGCAGGTATTGGGGGCGTTCCGGAATTGAGGGGTGGTTGTAGTGGTGGCTTAGGAATACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl