Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07695

HP ID(1) HP07695
Gene ID(2) 23325
Gene Symbol finder KIAA1033
Protein Name KIAA1033
RefSeq NM_015275.1
Length of RefSeq (bp) 5823
Chromosome 12q24.11
Reference DDBJ accession
UniGene Hs.12144

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi30G05 pGCAP10 GACTGTTAAAGAGATTTTTTTAAAAATGCAAAGAAACAGAAAAAACAAGGAGAGAGTACA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl