Prev. |  KEGG KO K18465 > 

RIKEN DNA Bank Human Resource - WASHC4

Gene ID NCBI Gene 23325 |  KEGG hsa:23325
Gene Symbol WASHC4
Protein Name WASH complex subunit 4
Synonyms KIAA1033|MRT43|SWIP
Featured content Endocytosis (human)
Ortholog resource in our bank

  WASHC4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017034 IRAK042J18 pCMV-SPORT6 BC031358 NM_015275 Partial
HGX035254 IRAK088C06 pCMV-SPORT6 BC040936 NM_015275 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172149 ARi30G05 pGCAP10 NM_015275.1  
GACTGTTAAAGAGATTTTTTTAAAAATGCAAAGAAACAGAAAAAACAAGGAGAGAGTACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl