Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07694

HP ID(1) HP07694
Gene ID(2) 2683
Gene Symbol finder B4GALT1
Protein Name UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
RefSeq NM_001497.2
Length of RefSeq (bp) 4080
Chromosome 9p13
Reference DDBJ accession
UniGene Hs.272011

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi30F04 pGCAP10 GACACCCTTCTTAAAGCGGCGGCGGGAAGATGAGGCTTCGGGAGCCGCTCCTGAGCGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl