DNA Bank Top |  KEGG KO K07966 > 

RIKEN DNA Bank Human Resource - B4GALT1

Gene ID NCBI Gene 2683 |  KEGG hsa:2683
Gene Symbol B4GALT1
Protein Name beta-1,4-galactosyltransferase 1
Synonyms B4GAL-T1|CDG2D|GGTB2|GT1|GTB|beta4Gal-T1

Link

Ortholog resource in our bank

  B4GALT1


External database

human B4GALT1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19412 pFX-GalT-SECFP Expression vector of SECFP with Golgi-targeting sequence (human B4GALT1) in mammalian cells.    
RDB17816 pN1-golgi-QUE37C ATP measurement, Golgi apparatus    
RDB13355 pONL-N1_Golgi Orange Nano-lantern for labeling of Golgi apparatus by the N-terminal 81 amino acids of human beta 1,4-galactosyltransferase.    
RDB13354 pCNL-N1_Golgi Cyan Nano-lantern for labeling of Golgi apparatus by the N-terminal 81 amino acids of human beta 1,4-galactosyltransferase.    
RDB13353 pYNL-N1_Golgi Yellow Nano-lantern for labeling of Golgi apparatus by the N-terminal 81 amino acids of human beta 1,4-galactosyltransferase.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036248 IRAK090K08 pBluescript BC045773 NM_001497 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040416 W01A101A16 pENTR-TOPO IRAK090K08 BC045773 NM_001497 done
HGE040418 W01A101A18 pENTR-TOPO IRAK090K08 BC045773 NM_001497  
HGE040422 W01A101A22 pENTR-TOPO IRAK090K08 BC045773 NM_001497  
HGE040424 W01A101A24 pENTR-TOPO IRAK090K08 BC045773 NM_001497  
HGE040452 W01A101C04 pENTR-TOPO IRAK090K08 BC045773 NM_001497  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172124 ARi30F04 pGCAP10 NM_001497.2 done
GACACCCTTCTTAAAGCGGCGGCGGGAAGATGAGGCTTCGGGAGCCGCTCCTGAGCGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl