Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07692

HP ID(1) HP07692
Gene ID(2) 200942
Gene Symbol finder KLHDC8B
Protein Name kelch domain containing 8B
RefSeq NM_173546.1
Length of RefSeq (bp) 1993
Chromosome 3p21.31
Reference DDBJ accession
UniGene Hs.13781

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi30B06 pGCAP10 GAGTGCCGGAGCCCCGCCAGAGCCCGACTTCAGCCCCAGCCAGATCCCGCGTCAACGGAG
RBdS104G20 pGCAP10 GAGAGCCCGACTTCAGCCCCAGCCAGATCCCGCGTCAACGGAGGCGGAACGGCGGACCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl