Prev. | 

RIKEN DNA Bank Human Resource - KLHDC8B

Gene ID NCBI Gene 200942 |  KEGG hsa:200942
Gene Symbol KLHDC8B
Protein Name kelch domain containing 8B
Synonyms CHL
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010730 IRAK026N18 pCMV-SPORT6 BC013110 NM_173546 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172030 ARi30B06 pGCAP10 NM_173546.1  
GAGTGCCGGAGCCCCGCCAGAGCCCGACTTCAGCCCCAGCCAGATCCCGCGTCAACGGAG
HKR441764 RBdS104G20 pGCAP10 NM_173546.1  
GAGAGCCCGACTTCAGCCCCAGCCAGATCCCGCGTCAACGGAGGCGGAACGGCGGACCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl