Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07676

HP ID(1) HP07676
Gene ID(2) 8148
Gene Symbol finder TAF15
Protein Name TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa
RefSeq NM_139215.1
Length of RefSeq (bp) 2153
Chromosome 17q11.1-q11.2
Reference DDBJ accession
UniGene Hs.402752

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi69A10 pGCAP10 GCTCAGTACAGCTCCGGCCGCCGCGCCGCCTGGCTTTCGTATTCGTTGTTCTCGGCGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl