Prev. |  KEGG KO K14651 > 

RIKEN DNA Bank Human Resource - TAF15

Gene ID NCBI Gene 8148 |  KEGG hsa:8148
Gene Symbol TAF15
Protein Name TATA-box binding protein associated factor 15
Synonyms Npl3|RBP56|TAF2N|TAFII68
Ortholog resource in our bank

  TAF15

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007794 IRAK019I02 pCMV-SPORT6 BC039129 NM_139215 Partial
HGY013763 IRAK034G19 pBluescriptR BC030591 NM_139215 Partial/var
HGY042639 IRAK106J23 pBluescript BC048985 NM_139215 Partial/var
HGX043066 IRAK107L02 pCMV-SPORT6 BC046099 NM_139215 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037122 W01A092N10 pENTR-TOPO IRAK107L02 BC046099 NM_139215  
HGE037130 W01A092N18 pENTR-TOPO IRAK107L02 BC046099 NM_139215  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR187610 ARi69A10 pGCAP10 NM_139215.1  
GCTCAGTACAGCTCCGGCCGCCGCGCCGCCTGGCTTTCGTATTCGTTGTTCTCGGCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl