Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07673

HP ID(1) HP07673
Gene ID(2) 58525
Gene Symbol finder WIZ
Protein Name widely-interspaced zinc finger motifs
RefSeq NM_021241.2
Length of RefSeq (bp) 4185
Chromosome 19p13.1
Reference DDBJ accession
UniGene Hs.442138

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi68D01 pGCAP10 GGCCTGGGGCGGCCGCCCCGCGTGCGCCGGAGCCAAGATGGCCGCCTCCACCGCCCAGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl