Prev. | 

RIKEN DNA Bank Human Resource - WIZ

Gene ID NCBI Gene 58525 |  KEGG hsa:58525
Gene Symbol WIZ
Protein Name WIZ zinc finger
Synonyms ZNF803
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084583 IRAL011H15 pOTB7 BC002329 XM_944977 Partial
HGY088895 IRAL022D23 pOTB7 BC007551 XM_944977 Partial
HGY092040 IRAL030B16 pOTB7 BC014220 XM_944977 Partial/var
HGY100141 IRAL050F21 pOTB7 BC062360 XM_944977 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR187273 ARi68D01 pGCAP10 NM_021241.2  
GGCCTGGGGCGGCCGCCCCGCGTGCGCCGGAGCCAAGATGGCCGCCTCCACCGCCCAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl