Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07651

HP ID(1) HP07651
Gene ID(2) 23299
Gene Symbol finder BICD2
Protein Name bicaudal D homolog 2 (Drosophila)
RefSeq NM_015250.3
Length of RefSeq (bp) 4625
Chromosome 9q22.31
Reference DDBJ accession
UniGene Hs.436939

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi63B12 pGCAP10 GAGGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCTGAGGAGGGCCCGGCCTGCGAGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl