Prev. |  KEGG KO K18739 > 

RIKEN DNA Bank Human Resource - BICD2

Gene ID NCBI Gene 23299 |  KEGG hsa:23299
Gene Symbol BICD2
Protein Name BICD cargo adaptor 2
Synonyms SMALED2|SMALED2A|SMALED2B|bA526D8.1
Ortholog resource in our bank

  BICD2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069858 IRAK174K18 pCMV-SPORT6 BC073970 NM_015250 Full/var
HGY085391 IRAL013H23 pOTB7 BC004296 NM_015250 Partial
HGY089150 IRAL022O14 pOTB7 BC010428 NM_015250 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR185236 ARi63B12 pGCAP10 NM_015250.3  
GAGGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCTGAGGAGGGCCCGGCCTGCGAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl