Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07650

HP ID(1) HP07650
Gene ID(2) 9924
Gene Symbol finder PAN2
Protein Name PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae)
RefSeq NM_014871.2
Length of RefSeq (bp) 4509
Chromosome 12q13.2-q13.3
Reference DDBJ accession
UniGene Hs.273397

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi62H03 pGCAP10 TGCTTGGCGCCGTAGTGGTTAGGTTGAGCCCTAGGCGTGGGGGAGAACTGGGGAAACTGG
RBdS040D24 pGCAP10 GAGGTTGAGCCCTAGGCGTGGGGGAGAACTGGGGAAACTGGAATTTCCCGCGGAGCTGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl