Prev. |  KEGG KO K12571 > 

RIKEN DNA Bank Human Resource - PAN2

Gene ID NCBI Gene 9924 |  KEGG hsa:9924
Gene Symbol PAN2
Protein Name PAN2 poly(A) specific ribonuclease subunit
Synonyms USP52
Ortholog resources KEGG ortholog (KEGG orthology K12571) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082562 IRAL006G18 pOTB7 BC024043 NM_014871

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081208 M01C003A08 pDONR221 04-134-2_2-B04 BC024043 ENST00000257931  
HGE081256 M01C003C08 pDONR221 04-134-2_2-B04 BC024043 ENST00000257931  
HGE081304 M01C003E08 pDONR221 04-134-2_2-B04 BC024043 ENST00000257931  
HGE081352 M01C003G08 pDONR221 04-134-2_2-B04 BC024043 ENST00000257931  
HGE081400 M01C003I08 pDONR221 04-134-2_2-B04 BC024043 ENST00000257931  
HGE081448 M01C003K08 pDONR221 04-134-2_2-B04 BC024043 ENST00000257931  
HGE081496 M01C003M08 pDONR221 04-134-2_2-B04 BC024043 ENST00000257931  
HGE081544 M01C003O08 pDONR221 04-134-2_2-B04 BC024043 ENST00000257931  
HGE111233 M01C078B09 pDONR221 06-2_02-G05 BC024043 ENST00000257931  
HGE097225 M01C043B01 pDONR221 MGC11-C01 BC024043 ENST00000257931  
HGE097273 M01C043D01 pDONR221 MGC11-C01 BC024043 ENST00000257931  
HGE097321 M01C043F01 pDONR221 MGC11-C01 BC024043 ENST00000257931  
HGE097369 M01C043H01 pDONR221 MGC11-C01 BC024043 ENST00000257931  
HGE097417 M01C043J01 pDONR221 MGC11-C01 BC024043 ENST00000257931  
HGE097465 M01C043L01 pDONR221 MGC11-C01 BC024043 ENST00000257931  
HGE097513 M01C043N01 pDONR221 MGC11-C01 BC024043 ENST00000257931  
HGE097561 M01C043P01 pDONR221 MGC11-C01 BC024043 ENST00000257931  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR184971 ARi62H03 pGCAP10 NM_014871.2  
TGCTTGGCGCCGTAGTGGTTAGGTTGAGCCCTAGGCGTGGGGGAGAACTGGGGAAACTGG
HKR416096 RBdS040D24 pGCAP10 NM_014871.2  
GAGGTTGAGCCCTAGGCGTGGGGGAGAACTGGGGAAACTGGAATTTCCCGCGGAGCTGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl