Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07638

HP ID(1) HP07638
Gene ID(2) 9960
Gene Symbol finder USP3
Protein Name ubiquitin specific peptidase 3
RefSeq NM_006537.2
Length of RefSeq (bp) 2345
Chromosome 15q22.3
Reference DDBJ accession
UniGene Hs.458499

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi60G11 pGCAP10 GGCCGTCGGCCGAGCGCCCGGCTAGAAGCGACACCAGACGGAGCCTCCGGAGTTCCTCCG
RBd39E05 pGCAP10 GAGCGCCCGGCTAGAAGCGACACCAGACGGAGCCTCCGGAGTTCCTCCGCCCCCACCTCG
RBd52F02 pGCAP10 GAGCGCCCGGCTAGAAGCGACACCAGACGGAGCCTCCGGAGTTCCTCCGCCCCCACCTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl