Prev. |  KEGG KO K11986 > 

RIKEN DNA Bank Human Resource - USP3

Gene ID NCBI Gene 9960 |  KEGG hsa:9960
Gene Symbol USP3
Protein Name ubiquitin specific peptidase 3
Synonyms SIH003|UBP
Ortholog resources KEGG ortholog (KEGG orthology K11986) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR184155 ARi60G11 pGCAP10 NM_006537.2  
GGCCGTCGGCCGAGCGCCCGGCTAGAAGCGACACCAGACGGAGCCTCCGGAGTTCCTCCG
HKR375701 RBd39E05 pGCAP10 NM_006537.2  
GAGCGCCCGGCTAGAAGCGACACCAGACGGAGCCTCCGGAGTTCCTCCGCCCCCACCTCG
HKR380922 RBd52F02 pGCAP10 NM_006537.2  
GAGCGCCCGGCTAGAAGCGACACCAGACGGAGCCTCCGGAGTTCCTCCGCCCCCACCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl