Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07633

HP ID(1) HP07633
Gene ID(2) 64207
Gene Symbol finder C14orf4
Protein Name chromosome 14 open reading frame 4
RefSeq NM_024496.2
Length of RefSeq (bp) 4166
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.179260

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi60B10 pGCAP10 GGGGAAGAACTGGTGCAGAGCATGGCGGTGACGTCAGCGCTCCGCCCGGGCGGCATCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl