Prev. |  KEGG KO K22383 > 

RIKEN DNA Bank Human Resource - IRF2BPL

Gene ID NCBI Gene 64207 |  KEGG hsa:64207
Gene Symbol IRF2BPL
Protein Name interferon regulatory factor 2 binding protein like
Synonyms C14orf4|EAP1|NEDAMSS
Ortholog resource in our bank

  IRF2BPL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184034 ARi60B10 pGCAP10 NM_024496.2 VA done
GGGGAAGAACTGGTGCAGAGCATGGCGGTGACGTCAGCGCTCCGCCCGGGCGGCATCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl