Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07631

HP ID(1) HP07631
Gene ID(2) 93587
Gene Symbol finder RG9MTD2
Protein Name RNA (guanine-9-) methyltransferase domain containing 2
RefSeq NM_152292.4
Length of RefSeq (bp) 3722
Chromosome 4q23
Reference DDBJ accession
UniGene Hs.380412

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi59B12 pGCAP10 GCTCCACTGCGTAACTACCGCCCCTGCCTCTGGGAATTGAAGTTTCTGTGGAAGGAAGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl