Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07615

HP ID(1) HP07615
Gene ID(2) 3093
Gene Symbol finder UBE2K
Protein Name ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)
RefSeq NM_005339.4
Length of RefSeq (bp) 5259
Chromosome 4p14
Reference DDBJ accession
UniGene Hs.714332

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi31A11 pGCAP10 GATGCGCCGACCCGGCGCCATTTTGGTGGCCGGGCGCGGAGGTGATTCCACACTGAGGCG
ARi56H12 pGCAP10 ATTTTGGTGGCCGGGCGCGGAGGTGATTCCACACTGAGGCGAGCGCGGCGGCCGGGGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl