Prev. |  KEGG KO K04649 > 

RIKEN DNA Bank Human Resource - UBE2K

Gene ID NCBI Gene 3093 |  KEGG hsa:3093
Gene Symbol UBE2K
Protein Name ubiquitin conjugating enzyme E2 K
Synonyms E2-25K|HIP2|HYPG|LIG|UBC1
Ortholog resources KEGG ortholog (KEGG orthology K04649) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044357 IRAK110O21 pCMV-SPORT6 BC050600 NM_005339 Full
HGY097034 IRAL042J18 pOTB7 BC022804 NM_005339 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE009489 W01A023M01 pENTR-TOPO IRAK110O21 BC050600 NM_005339  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172411 ARi31A11 pGCAP10 NM_005339.4  
GATGCGCCGACCCGGCGCCATTTTGGTGGCCGGGCGCGGAGGTGATTCCACACTGAGGCG
HKR182580 ARi56H12 pGCAP10 NM_005339.4  
ATTTTGGTGGCCGGGCGCGGAGGTGATTCCACACTGAGGCGAGCGCGGCGGCCGGGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl