Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07612

HP ID(1) HP07612
Gene ID(2) 26031
Gene Symbol finder OSBPL3
Protein Name oxysterol binding protein-like 3
RefSeq NM_015550.2
Length of RefSeq (bp) 6730
Chromosome 7p15
Reference DDBJ accession
UniGene Hs.520259

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi56E03 pGCAP10 GGAAGTTCTGGGCAAAGTACTCAGAACTGGCCGCGTGCTGGTGGCGCCCGCCAGCCGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl