Prev. |  KEGG KO K20463 > 

RIKEN DNA Bank Human Resource - OSBPL3

Gene ID NCBI Gene 26031 |  KEGG hsa:26031
Gene Symbol OSBPL3
Protein Name oxysterol binding protein like 3
Synonyms ORP-3|ORP3|OSBP3
Ortholog resource in our bank

  OSBPL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009016 IRAK022I24 pCMV-SPORT6 BC017731 NM_015550 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092425 M01C031B01 pDONR221 MGC05-C01 BC017731 NM_015550  
HGE092473 M01C031D01 pDONR221 MGC05-C01 BC017731 NM_015550  
HGE092521 M01C031F01 pDONR221 MGC05-C01 BC017731 NM_015550  
HGE092569 M01C031H01 pDONR221 MGC05-C01 BC017731 NM_015550  
HGE092617 M01C031J01 pDONR221 MGC05-C01 BC017731 NM_015550  
HGE092665 M01C031L01 pDONR221 MGC05-C01 BC017731 NM_015550  
HGE092713 M01C031N01 pDONR221 MGC05-C01 BC017731 NM_015550  
HGE092761 M01C031P01 pDONR221 MGC05-C01 BC017731 NM_015550  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182499 ARi56E03 pGCAP10 NM_015550.2  
GGAAGTTCTGGGCAAAGTACTCAGAACTGGCCGCGTGCTGGTGGCGCCCGCCAGCCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl