Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07600

HP ID(1) HP07600
Gene ID(2) 5504
Gene Symbol finder PPP1R2
Protein Name protein phosphatase 1, regulatory (inhibitor) subunit 2
RefSeq NM_006241.4
Length of RefSeq (bp) 3475
Chromosome 3q29
Reference DDBJ accession
UniGene Hs.535731

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi55B06 pGCAP10 GGGCGTCGCGTCGCTCCTGCGCTGGAGCTCTAGGCCGGCGTCTCTCCGCGAGCCGCGGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl