Prev. |  KEGG KO K16833 > 

RIKEN DNA Bank Human Resource - PPP1R2

Gene ID NCBI Gene 5504 |  KEGG hsa:5504
Gene Symbol PPP1R2
Protein Name protein phosphatase 1 regulatory inhibitor subunit 2
Synonyms IPP-2|IPP2
Ortholog resources KEGG ortholog (KEGG orthology K16833) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY066921 IRAK167F01 pBluescriptR BC066921 NM_006241 Partial
HGY082352 IRAL005O16 pOTB7 BC007655 NM_006241

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081202 M01C003A02 pDONR221 04-134-2_2-B01 BC007655 NM_006241  
HGE081250 M01C003C02 pDONR221 04-134-2_2-B01 BC007655 NM_006241  
HGE081298 M01C003E02 pDONR221 04-134-2_2-B01 BC007655 NM_006241  
HGE081346 M01C003G02 pDONR221 04-134-2_2-B01 BC007655 NM_006241  
HGE081394 M01C003I02 pDONR221 04-134-2_2-B01 BC007655 NM_006241  
HGE081442 M01C003K02 pDONR221 04-134-2_2-B01 BC007655 NM_006241  
HGE081490 M01C003M02 pDONR221 04-134-2_2-B01 BC007655 NM_006241  
HGE081538 M01C003O02 pDONR221 04-134-2_2-B01 BC007655 NM_006241  
HGE097205 M01C043A05 pDONR221 MGC11-A03 BC007655 NM_006241  
HGE097253 M01C043C05 pDONR221 MGC11-A03 BC007655 NM_006241  
HGE097301 M01C043E05 pDONR221 MGC11-A03 BC007655 NM_006241  
HGE097349 M01C043G05 pDONR221 MGC11-A03 BC007655 NM_006241  
HGE097397 M01C043I05 pDONR221 MGC11-A03 BC007655 NM_006241  
HGE097445 M01C043K05 pDONR221 MGC11-A03 BC007655 NM_006241  
HGE097493 M01C043M05 pDONR221 MGC11-A03 BC007655 NM_006241  
HGE097541 M01C043O05 pDONR221 MGC11-A03 BC007655 NM_006241  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR182030 ARi55B06 pGCAP10 NM_006241.4  
GGGCGTCGCGTCGCTCCTGCGCTGGAGCTCTAGGCCGGCGTCTCTCCGCGAGCCGCGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl