Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07599

HP ID(1) HP07599
Gene ID(2) 5521
Gene Symbol finder PPP2R2B
Protein Name protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform
RefSeq NM_004576.2
Length of RefSeq (bp) 2300
Chromosome 5q32
Reference DDBJ accession
UniGene Hs.655213

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi54G06 pGCAP10 GAGCCGCCTCCAGCCTCCTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl